Recipe View

How to create and query a custom BLAST database

This recipe demonstrates the creation of custom nucleotide and protein databases.

1 result • updated 3.5 years ago by Istvan Albert

This recipe demonstrates the creation of custom nucleotide and protein databases.

The recipe download the genomic and proteomic data described in Genomic surveillance elucidates Ebola virus origin then creates BLAST ready databases that is then queried with:

>mystery
ATGGACTCTCGTCCTCAGAAAGTCTGGATGACGCCGAGTCTCACTGAATCTGACATGGAT
TACCACAAGATCTTGACAGCAGGTCTGTCCGTTCAACAGGGGGTTGTTCGGCAAAGAGTC
ATCCCAGTGTATCAAGTAAACAATCTTGAG

Various example outputs can be seen for searches in nucleotide and peptide space.

For more information see the

Applied Bioinformatics online course
Biostar Handbook for system setup and other information.

Copy recipe

You need write access to the project to edit.

# Stop script on any error.
set -ux

# Make a directory to store the blast database
mkdir -p db

# Download the proteins deposited at NCBI for project PRJNA257197
esearch -db protein -query PRJNA257197 | efetch -format fasta > db/proteins.fa

# Download the nucleotides deposited at NCBI for project PRJNA257197
esearch -db nuccore -query PRJNA257197 | efetch -format fasta > db/genomes.fa

# Build the blast index for proteins.
makeblastdb -in db/proteins.fa -dbtype prot -out db/ebov_prots -parse_seqids

# Build the blast index for proteins.
makeblastdb -in db/genomes.fa -dbtype nucl -out db/ebov_genomes -parse_seqids

# Get information on the database
blastdbcmd -db db/ebov_prots -info

# Make a mystery query
echo ">mystery" > foo.fa
echo "ATGGACTCTCGTCCTCAGAAAGTCTGGATGACGCCGAGTCTCACTGAATCTGACATGGAT" >> foo.fa
echo "TACCACAAGATCTTGACAGCAGGTCTGTCCGTTCAACAGGGGGTTGTTCGGCAAAGAGTC" >> foo.fa
echo "ATCCCAGTGTATCAAGTAAACAATCTTGAG" >> foo.fa

# The format string for each query.
F='6 qacc sacc pident qlen length frames'

# Perform a search in nucleotide space.
blastn -db db/ebov_genomes  -query foo.fa -outfmt "$F" | sort -k 3rn > results_blastn.txt

# Perform a search in protein space.
blastx -db db/ebov_prots  -query foo.fa -outfmt "$F" | sort -k 3rn > results_blastx.txt

# Perform a search in translated nucleotide spaces.
tblastx -db db/ebov_genomes -query foo.fa -outfmt "$F" | sort -k 3rn > results_tblastn.txt

You need write access to the original recipe to edit.

Click the buttons on the right to create new fields.

Add text field Add float field Add data field Add checkbox Add dropdown Add upload field Add integer field Add radio button

Name

Recipe display name

Identifier

Unique identifier for the recipe.

Image :

Optional image for the recipe ( 500px Maximum ).

Rank:

Used to order recipes (optional).

Insert Image

From the web

From your computer

Cancel

Back