How to create and query a custom BLAST database

How to create and query a custom BLAST database

This recipe demonstrates the creation of custom nucleotide and protein databases.

1 result • updated 3.6 years ago by Istvan Albert

This recipe demonstrates the creation of custom nucleotide and protein databases.

The recipe download the genomic and proteomic data described in Genomic surveillance elucidates Ebola virus origin then creates BLAST ready databases that is then queried with:

>mystery
ATGGACTCTCGTCCTCAGAAAGTCTGGATGACGCCGAGTCTCACTGAATCTGACATGGAT
TACCACAAGATCTTGACAGCAGGTCTGTCCGTTCAACAGGGGGTTGTTCGGCAAAGAGTC
ATCCCAGTGTATCAAGTAAACAATCTTGAG

Various example outputs can be seen for searches in nucleotide and peptide space.

For more information see the

Copy recipe
You need write access to the project to edit.
You need write access to the original recipe to edit.
Recipe Interface Builder
Click the buttons on the right to create new fields.
Interface Editor
Edit the content of each interface element.
You need write access to the original recipe to edit.
Edit Recipe
Recipe display name
Unique identifier for the recipe.
Image :
Optional image for the recipe ( 500px Maximum ).
Rank:
Used to order recipes (optional).

Insert Image

Back

Powered by the release 2.3.6